Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1583838
End position: 1583864
Length: 27

DNA sequence
>NC_008048, from 1583838 to 1583864 (27 bp); Sphingopyxis alaskensis RB2256 CAGCGCCGCCTGCGCCGCCAGCGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1582264-1584234	Sequence	Sala_1516 - cytochrome c assembly protein (Protein is coded in complementary strand; from 1584234 to 1582264)