Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 3208094
End position: 3208120
Length: 27

DNA sequence
>NC_008048, from 3208094 to 3208120 (27 bp); Sphingopyxis alaskensis RB2256 CGCCTTCGTCGCCTTCGCTGCCTTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3208086-3209393	Sequence	Sala_3058 - mechanosensitive ion channel protein MscS (Protein is coded in complementary strand; from 3209393 to 3208086)