Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 3327026
End position: 3327052
Length: 27

DNA sequence
>NC_008048, from 3327026 to 3327052 (27 bp); Sphingopyxis alaskensis RB2256 CGCGGCGACCGCGGCGGCTGCGGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3326431-3329076	Sequence	Sala_3172 - ribonuclease (Protein is coded in complementary strand; from 3329076 to 3326431)