Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 463036
End position: 463062
Length: 27

DNA sequence
>NC_008048, from 463036 to 463062 (27 bp); Sphingopyxis alaskensis RB2256 CCATGCCGCCCATGCCGCCCATGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 463029-464672	Sequence	Sala_0452 groEL chaperonin GroEL (Protein is coded in complementary strand; from 464672 to 463029)