Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 814127
End position: 814153
Length: 27

DNA sequence
>NC_008048, from 814127 to 814153 (27 bp); Sphingopyxis alaskensis RB2256 GGCGGCGCGGGTGGCGCGGGCGGCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 813821-814474	Sequence	Sala_0808 - TonB-like protein (Protein is coded in complementary strand; from 814474 to 813821)