Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 2027373
End position: 2027402
Length: 30

DNA sequence
>NC_008048, from 2027373 to 2027402 (30 bp); Sphingopyxis alaskensis RB2256 AGCCGCCGCCGCCCGCCGCCAGCGTCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2027096-2027956	Sequence	Sala_1923 - polysaccharide deacetylase (Protein is coded in complementary strand; from 2027956 to 2027096)