Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1392245
End position: 1392280
Length: 36

DNA sequence
>NC_008048, from 1392245 to 1392280 (36 bp); Sphingopyxis alaskensis RB2256 ACAGGCCCTCCCCCAGCCCCTCCCCCAGCCCCTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1391318-1392643	Sequence	Sala_1329 - branched-chain alpha-keto acid dehydrogenase subunit E2 (Protein is coded in complementary strand; from 1392643 to 1391318)