Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 3249581
End position: 3249616
Length: 36

DNA sequence
>NC_008048, from 3249581 to 3249616 (36 bp); Sphingopyxis alaskensis RB2256 GCCGACGCCCGCGCCGGCGACCGCGCCGATACCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3249126-3249818	Sequence	Sala_3101 - OmpA/MotB protein (Protein is coded in complementary strand; from 3249818 to 3249126)