Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1298742
End position: 1298786
Length: 45

DNA sequence
>NC_008048, from 1298742 to 1298786 (45 bp); Sphingopyxis alaskensis RB2256 GCGCGATCAGGCCAAGCTCGACGAGGCCAAGCGCGAGCCCGCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1297874-1298968	Sequence	Sala_1247 - acyl-CoA dehydrogenase-like protein (Protein is coded in complementary strand; from 1298968 to 1297874)