Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 2503291
End position: 2503335
Length: 45

DNA sequence
>NC_008048, from 2503291 to 2503335 (45 bp); Sphingopyxis alaskensis RB2256 GGCCAGAAACGCCTGGGCCGAAAACACCTGGGCCGGAAACACCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2500247-2503351	Sequence	Sala_2379 - TonB-dependent receptor (Protein is coded in complementary strand; from 2503351 to 2500247)