Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 2097051
End position: 2097104
Length: 54

DNA sequence
>NC_008048, from 2097051 to 2097104 (54 bp); Sphingopyxis alaskensis RB2256 GGCGGCGGAGGCGGCGGGGGCGGCGGGGGCGGCGGGGGCGGCGGAGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2096682-2097803	Sequence	Sala_1988 - OmpA/MotB protein (Protein is coded in complementary strand; from 2097803 to 2096682)