Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 730220
End position: 730282
Length: 63

DNA sequence
>NC_008048, from 730220 to 730282 (63 bp); Sphingopyxis alaskensis RB2256 TGACGCCCCCGGTCGAGGTCGACACGCCGCCCGTCGAGGTCGACACGCCGCCGGTTGAGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 729706-731151	Sequence	Sala_0723 - hypothetical protein (Protein is coded in complementary strand; from 731151 to 729706)