Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 1116507
End position: 1116530
Length: 24

DNA sequence
>NC_008095, from 1116507 to 1116530 (24 bp); Myxococcus xanthus DK 1622 GCACCAGCACCAGCAACACCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1116437-1117054	Sequence	MXAN_0967 - D-methionine ABC transporter permease (Protein is coded in complementary strand; from 1117054 to 1116437)