Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 1135727
End position: 1135750
Length: 24

DNA sequence
>NC_008095, from 1135727 to 1135750 (24 bp); Myxococcus xanthus DK 1622 CCAGCGTCAGCGCCAGCCCCAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1134064-1137186	Sequence	MXAN_0983 - CzcA family heavy metal efflux protein (Protein is coded in complementary strand; from 1137186 to 1134064)