Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 1398647
End position: 1398670
Length: 24

DNA sequence
>NC_008095, from 1398647 to 1398670 (24 bp); Myxococcus xanthus DK 1622 CACGGCCACGGCCGCGGCGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1395978-1401962	Sequence	MXAN_1195 - hypothetical protein (Protein is coded in complementary strand; from 1401962 to 1395978)