Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 189904
End position: 189927
Length: 24

DNA sequence
>NC_008095, from 189904 to 189927 (24 bp); Myxococcus xanthus DK 1622 CAGGGCCAGCGCCAGGGCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 189029-190387	Sequence	MXAN_0153 - ATPase (Protein is coded in complementary strand; from 190387 to 189029)