Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 1909575
End position: 1909598
Length: 24

DNA sequence
>NC_008095, from 1909575 to 1909598 (24 bp); Myxococcus xanthus DK 1622 GGCGCGGGAGCGGGAGCGGGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1908333-1910318	Sequence	MXAN_1608 - hypothetical protein (Protein is coded in complementary strand; from 1910318 to 1908333)