Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 2009589
End position: 2009612
Length: 24

DNA sequence
>NC_008095, from 2009589 to 2009612 (24 bp); Myxococcus xanthus DK 1622 GCGGTGTCGGTGGCGGTCGCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2009028-2011427	Sequence	MXAN_1696 - Ig-like domain-containing protein (Protein is coded in complementary strand; from 2011427 to 2009028)