Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 2072203
End position: 2072226
Length: 24

DNA sequence
>NC_008095, from 2072203 to 2072226 (24 bp); Myxococcus xanthus DK 1622 GTACTCGTAGTCGTAGTCGTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2071622-2073118	Sequence	MXAN_1746 - GntR family transcriptional regulator (Protein is coded in complementary strand; from 2073118 to 2071622)