Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 2257190
End position: 2257213
Length: 24

DNA sequence
>NC_008095, from 2257190 to 2257213 (24 bp); Myxococcus xanthus DK 1622 GGCGCGGGCGCCTGCGCGGGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2254853-2257282	Sequence	MXAN_1923 - hypothetical protein (Protein is coded in complementary strand; from 2257282 to 2254853)