Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 2422246
End position: 2422269
Length: 24

DNA sequence
>NC_008095, from 2422246 to 2422269 (24 bp); Myxococcus xanthus DK 1622 TCGCCGTCGACGACGCCGTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2421541-2423460	Sequence	MXAN_2090 - OmpA domain-containing protein (Protein is coded in complementary strand; from 2423460 to 2421541)