Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 2860343
End position: 2860366
Length: 24

DNA sequence
>NC_008095, from 2860343 to 2860366 (24 bp); Myxococcus xanthus DK 1622 GTGGCGGCGGCGGCGGCGGTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2860154-2860378	Sequence	MXAN_2457 - hypothetical protein (Protein is coded in complementary strand; from 2860378 to 2860154)