Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 2862735
End position: 2862758
Length: 24

DNA sequence
>NC_008095, from 2862735 to 2862758 (24 bp); Myxococcus xanthus DK 1622 GTGGCGGCGGCGGCGGCGGTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2862546-2862770	Sequence	MXAN_2460 - hypothetical protein (Protein is coded in complementary strand; from 2862770 to 2862546)