Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 330069
End position: 330092
Length: 24

DNA sequence
>NC_008095, from 330069 to 330092 (24 bp); Myxococcus xanthus DK 1622 GGAGGCGGGGGCGGAGGAGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 329523-330332	Sequence	MXAN_0276 tonB ferric siderophore transporter, periplasmic energy transduction protein TonB (Protein is coded in complementary strand; from 330332 to 329523)