Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 3500400
End position: 3500423
Length: 24

DNA sequence
>NC_008095, from 3500400 to 3500423 (24 bp); Myxococcus xanthus DK 1622 ATGCCCATGCCCGTGCCCGTGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3499242-3500582	Sequence	MXAN_2986 - hypothetical protein (Protein is coded in complementary strand; from 3500582 to 3499242)