Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 3504859
End position: 3504882
Length: 24

DNA sequence
>NC_008095, from 3504859 to 3504882 (24 bp); Myxococcus xanthus DK 1622 GCCGGGGCCGGGGCCTGGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3504676-3508863	Sequence	MXAN_2991 aglZ adventurous gliding motility protein AglZ (Protein is coded in complementary strand; from 3508863 to 3504676)