Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 3881289
End position: 3881312
Length: 24

DNA sequence
>NC_008095, from 3881289 to 3881312 (24 bp); Myxococcus xanthus DK 1622 GGAGGCGGGGGCGGAGGAGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3880785-3882395	Sequence	MXAN_3338 - serine/threonine protein kinase (Protein is coded in complementary strand; from 3882395 to 3880785)