Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 4004142
End position: 4004165
Length: 24

DNA sequence
>NC_008095, from 4004142 to 4004165 (24 bp); Myxococcus xanthus DK 1622 GCCTCCGCTTCCGCCTTCACCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4003251-4005395	Sequence	MXAN_3440 - M13 family peptidase (Protein is coded in complementary strand; from 4005395 to 4003251)