Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 4094342
End position: 4094365
Length: 24

DNA sequence
>NC_008095, from 4094342 to 4094365 (24 bp); Myxococcus xanthus DK 1622 CGCCGCCGCCACGGCCGCCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4094025-4095425	Sequence	MXAN_3514 pyk pyruvate kinase (Protein is coded in complementary strand; from 4095425 to 4094025)