Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 444990
End position: 445013
Length: 24

DNA sequence
>NC_008095, from 444990 to 445013 (24 bp); Myxococcus xanthus DK 1622 CACCGCCACACCGTCACACAGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 444118-445479	Sequence	MXAN_0379 - lipoprotein (Protein is coded in complementary strand; from 445479 to 444118)