Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 4474674
End position: 4474697
Length: 24

DNA sequence
>NC_008095, from 4474674 to 4474697 (24 bp); Myxococcus xanthus DK 1622 CGCCGTCCCCGTCGCCGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4472861-4474873	Sequence	MXAN_3755 - hypothetical protein
ORF. 4472894-4474858	Sequence	MXAN_3756 - hypothetical protein (Protein is coded in complementary strand; from 4474858 to 4472894)