Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 4612284
End position: 4612307
Length: 24

DNA sequence
>NC_008095, from 4612284 to 4612307 (24 bp); Myxococcus xanthus DK 1622 GGTGGCGGTGACGGTCGCGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4612120-4614267	Sequence	MXAN_3837 - cyclic nucleotide-binding protein (Protein is coded in complementary strand; from 4614267 to 4612120)