Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 4835107
End position: 4835130
Length: 24

DNA sequence
>NC_008095, from 4835107 to 4835130 (24 bp); Myxococcus xanthus DK 1622 CCGGCACCGTCACCGTCACCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4834386-4836092	Sequence	MXAN_3971 - lipoprotein (Protein is coded in complementary strand; from 4836092 to 4834386)