Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 5210807
End position: 5210830
Length: 24

DNA sequence
>NC_008095, from 5210807 to 5210830 (24 bp); Myxococcus xanthus DK 1622 CGTGGCCGTGCCCGTGGCCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5210335-5211015	Sequence	MXAN_4250 - phosphoribosyl transferase domain-containing protein