Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 5276880
End position: 5276903
Length: 24

DNA sequence
>NC_008095, from 5276880 to 5276903 (24 bp); Myxococcus xanthus DK 1622 GCGCCAACGCCAGCTCCAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5273237-5278798	Sequence	MXAN_4298 - polyketide synthase (Protein is coded in complementary strand; from 5278798 to 5273237)