Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 5389538
End position: 5389561
Length: 24

DNA sequence
>NC_008095, from 5389538 to 5389561 (24 bp); Myxococcus xanthus DK 1622 CCGTGTGCGTGTCCGTGCCCGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5389117-5389902	Sequence	MXAN_4386 kamE D-lysine 5,6-aminomutase subunit beta (Protein is coded in complementary strand; from 5389902 to 5389117)