Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 5492044
End position: 5492067
Length: 24

DNA sequence
>NC_008095, from 5492044 to 5492067 (24 bp); Myxococcus xanthus DK 1622 TCGGAGTCGGCGTCGGTGGCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5490103-5493198	Sequence	MXAN_4439 - hypothetical protein (Protein is coded in complementary strand; from 5493198 to 5490103)