Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 5889904
End position: 5889927
Length: 24

DNA sequence
>NC_008095, from 5889904 to 5889927 (24 bp); Myxococcus xanthus DK 1622 CCTTCGTCTTCGCCTTCGCCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5888844-5891669	Sequence	MXAN_4700 - serine/threonine protein kinase (Protein is coded in complementary strand; from 5891669 to 5888844)