Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 6000676
End position: 6000699
Length: 24

DNA sequence
>NC_008095, from 6000676 to 6000699 (24 bp); Myxococcus xanthus DK 1622 CGGCCTCCGCCTCCGCCTCCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5996770-6001965	Sequence	MXAN_4798 - hypothetical protein (Protein is coded in complementary strand; from 6001965 to 5996770)