Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 6206220
End position: 6206243
Length: 24

DNA sequence
>NC_008095, from 6206220 to 6206243 (24 bp); Myxococcus xanthus DK 1622 CGCCAGCTCCAGCGACAGCCCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6205675-6206457	Sequence	MXAN_4961 - hypothetical protein (Protein is coded in complementary strand; from 6206457 to 6205675)