Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 6279115
End position: 6279138
Length: 24

DNA sequence
>NC_008095, from 6279115 to 6279138 (24 bp); Myxococcus xanthus DK 1622 GCGGCGCAGCGGCGCGGCGGCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6277745-6280153	Sequence	MXAN_5023 - TonB dependent receptor (Protein is coded in complementary strand; from 6280153 to 6277745)