Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 6284465
End position: 6284488
Length: 24

DNA sequence
>NC_008095, from 6284465 to 6284488 (24 bp); Myxococcus xanthus DK 1622 CGTCCAGGTCCACGTCGACGCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6283252-6284655	Sequence	MXAN_5026 - vitamin K-dependent gamma-carboxylase-related protein