Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 628657
End position: 628680
Length: 24

DNA sequence
>NC_008095, from 628657 to 628680 (24 bp); Myxococcus xanthus DK 1622 CGCCTTCGTCTTCGTCTTCGCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 628544-628726	Sequence	MXAN_0545 - hypothetical protein (Protein is coded in complementary strand; from 628726 to 628544)