Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 632335
End position: 632358
Length: 24

DNA sequence
>NC_008095, from 632335 to 632358 (24 bp); Myxococcus xanthus DK 1622 GTTGCCGCTGCCGTTGCCGTTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 632081-632611	Sequence	MXAN_0549 - hypothetical protein (Protein is coded in complementary strand; from 632611 to 632081)