Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 6481757
End position: 6481780
Length: 24

DNA sequence
>NC_008095, from 6481757 to 6481780 (24 bp); Myxococcus xanthus DK 1622 CGCGCTCGCGCTCACGCTCACGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6479953-6482181	Sequence	MXAN_5187 - hypothetical protein (Protein is coded in complementary strand; from 6482181 to 6479953)