Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 6795636
End position: 6795659
Length: 24

DNA sequence
>NC_008095, from 6795636 to 6795659 (24 bp); Myxococcus xanthus DK 1622 CTTCGCCTTCTCCTTCGCCTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6791812-6796824	Sequence	MXAN_5456 - hypothetical protein (Protein is coded in complementary strand; from 6796824 to 6791812)