Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 6847674
End position: 6847697
Length: 24

DNA sequence
>NC_008095, from 6847674 to 6847697 (24 bp); Myxococcus xanthus DK 1622 CATGCGCAGGCGCATGGGCTTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6847576-6848460	Sequence	MXAN_5500 - GDSL-like lipase/acylhydrolase domain-containing protein (Protein is coded in complementary strand; from 6848460 to 6847576)