Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 7027694
End position: 7027717
Length: 24

DNA sequence
>NC_008095, from 7027694 to 7027717 (24 bp); Myxococcus xanthus DK 1622 AGCAGCGGCAGCAGCGGCAGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7026869-7027879	Sequence	MXAN_5663 batA BatA protein (Protein is coded in complementary strand; from 7027879 to 7026869)