Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 7036023
End position: 7036046
Length: 24

DNA sequence
>NC_008095, from 7036023 to 7036046 (24 bp); Myxococcus xanthus DK 1622 GCCACGTCCACGCCCACGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7035786-7036196	Sequence	MXAN_5673 - hypothetical protein (Protein is coded in complementary strand; from 7036196 to 7035786)