Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 7556800
End position: 7556823
Length: 24

DNA sequence
>NC_008095, from 7556800 to 7556823 (24 bp); Myxococcus xanthus DK 1622 AGCGCCAGCGCGAGCGGCAGCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7555747-7557489	Sequence	MXAN_6113 - hypothetical protein (Protein is coded in complementary strand; from 7557489 to 7555747)